Review



addgene 46944  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 92
      Buy from Supplier

    Structured Review

    Addgene inc addgene 46944
    Addgene 46944, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+46944/pIRES-Ap2a2-FKBP+(Plasmid+%2346944)/pmc10830484-337-40-49
    Average 92 stars, based on 2 article reviews
    addgene 46944 - by Bioz Stars, 2026-09
    92/100 stars

    Images

    Related Articles

    Construct:

    Article Title: DENND6A couples Arl8b to a Rab34/RILP/dynein complex regulating retrograde lysosomal trafficking and autophagy
    Article Snippet: .. The following constructs were custom synthesized by SynBio technologies: mito-mScarlet-DENND6A (DENND6A is human; vector- pmScarlet-i_C1, addgene 85044), mito-mScarlet (vector- pmScarlet-i_C1, Addgene 85044), DENND6A-GFP (vector- pEGFP-N1), GFP (vector- pEGFP-N1), PEX3(amino acids 1-42)-FKBP-mCherry (FK506-binding protein domain (FKBP) fragment was synthesized as per addgene 46944; vector- pEGFP-C1), FRB-GFP (FRB was amplified from addgene 59352; vector- pEGFP-N1), DENND6A-FRB-EGFP (vector- pEGFP-N1), GST-Rab34 (vector pGEX-6p-1), GST-Rab34Q111L (vector- pGEX-6p-1), GST-Rab34-T66N (vector- pGEX-6p-1), T7-RILP (vector- pET24a(+)), mCherry-Rab34 (vector- pEGFP-C1; replaced EGFP with custom synthesized Arl8bmCherry), Arl8b-mCherry (vector- vector- pEGFP-C1; replaced EGFP with mCherry), GSTArl8b QL (vector- pGEX-6p-1), GST-Arl8b TN (vector- pGEX-6p-1). .. Two guide RNAs (gRNAs) (Target_1-318: CGTCTCTCTTGCACGCCGAA; Target_2-442: CGGGTCAGCAAGACGCCCCG) were obtained from Applied Biological Materials and separately cloned into pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro to increase the chances of generating a KO line.

    Article Title: DENND6A couples Arl8b to a Rab34/RILP/dynein complex regulating retrograde lysosomal trafficking and autophagy
    Article Snippet: .. The following constructs were custom synthesized by SynBio technologies: mito-mScarlet-DENND6A (DENND6A is human; vector-pmScarlet-i_C1, addgene 85044), mito-mScarlet (vector-pmScarlet-i_C1, Addgene 85044), DENND6A-GFP (vector-pEGFP-N1), GFP (vector-pEGFP-N1), PEX3(amino acids 1-42)-FKBP-mCherry (FK506-binding protein domain (FKBP) fragment was synthesized as per addgene 46944; vector-pEGFP-C1), FRB-GFP (FRB was amplified from addgene 59352; vector-pEGFP-N1), DENND6A-FRB-EGFP (vector-pEGFP-N1), GST-Rab34 (vector pGEX-6p-1), GST-Rab34-Q111L (vector-pGEX-6p-1), GST-Rab34-T66N (vector-pGEX-6p-1), T7-RILP (vector-pET-24a(+)), mCherry-Rab34 (vector-pEGFP-C1; replaced EGFP with custom synthesized Arl8b-mCherry), Arl8b-mCherry (vector-vector-pEGFP-C1; replaced EGFP with mCherry), GST-Arl8b QL (vector-pGEX-6p-1), GST-Arl8b TN (vector-pGEX-6p-1). .. Two guide RNAs (gRNAs) (Target_1-318: CGTCTCTCTTGCACGCCGAA; Target_2-442: CGGGTCAGCAAGACGCCCCG) were obtained from Applied Biological Materials and separately cloned into pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro to increase the chances of generating a KO line.

    Article Title: DENND6A links Arl8b to a Rab34/RILP/dynein complex, regulating lysosomal positioning and autophagy
    Article Snippet: .. The following constructs were custom synthesized by SynBio technologies: mito-mScarlet-DENND6A (DENND6A is human; vector- pmScarlet-i_C1, addgene 85044), mito-mScarlet (vector- pmScarlet-i_C1, Addgene 85044), DENND6A-GFP (vector- pEGFP-N1), GFP (vector- pEGFP-N1), PEX3(amino acids 1-42)-FKBP-mCherry (FK506-binding protein domain (FKBP) fragment was synthesized as per addgene 46944; vector- pEGFP-C1), FRB-GFP (FRB was amplified from addgene 59352; vector- pEGFP-N1), DENND6A-FRB-EGFP (vector- pEGFP-N1), GST-Rab34 (vector pGEX-6p-1), GST-Rab34-Q111L (vector- pGEX-6p-1), GST-Rab34-T66N (vector- pGEX-6p-1), T7-RILP (vector- pET-24a(+)), mCherry-Rab34 (vector- pEGFP-C1; replaced EGFP with custom synthesized Arl8b-mCherry), Arl8b-mCherry (vector- pEGFP-C1; replaced EGFP with mCherry), GST-Arl8b QL (vector- pGEX-6p-1), GST-Arl8b TN (vector- pGEX-6p-1), mito-mScarlet-Arl8b QL (vector- pmScarlet-i_C1), mito-mScarlet-Arl8b QL (vector- pmScarlet-i_C1), Arl8b QL-FLAG (vector- pEGFP-C1, EGFP was replaced by custom synthesized Arl8b QL-FLAG), Arl8b TN-FLAG (vector- pEGFP-C1, EGFP was replaced by custom synthesized Arl8b QL-FLAG), GFP-Rab34 Q111L (pEGFP-C1), mScarlet-Rab34 (vector- pmScarlet-i_C1), GFP-DENND6A (vector- pEGFP-C1). ..

    Synthesized:

    Article Title: DENND6A couples Arl8b to a Rab34/RILP/dynein complex regulating retrograde lysosomal trafficking and autophagy
    Article Snippet: .. The following constructs were custom synthesized by SynBio technologies: mito-mScarlet-DENND6A (DENND6A is human; vector- pmScarlet-i_C1, addgene 85044), mito-mScarlet (vector- pmScarlet-i_C1, Addgene 85044), DENND6A-GFP (vector- pEGFP-N1), GFP (vector- pEGFP-N1), PEX3(amino acids 1-42)-FKBP-mCherry (FK506-binding protein domain (FKBP) fragment was synthesized as per addgene 46944; vector- pEGFP-C1), FRB-GFP (FRB was amplified from addgene 59352; vector- pEGFP-N1), DENND6A-FRB-EGFP (vector- pEGFP-N1), GST-Rab34 (vector pGEX-6p-1), GST-Rab34Q111L (vector- pGEX-6p-1), GST-Rab34-T66N (vector- pGEX-6p-1), T7-RILP (vector- pET24a(+)), mCherry-Rab34 (vector- pEGFP-C1; replaced EGFP with custom synthesized Arl8bmCherry), Arl8b-mCherry (vector- vector- pEGFP-C1; replaced EGFP with mCherry), GSTArl8b QL (vector- pGEX-6p-1), GST-Arl8b TN (vector- pGEX-6p-1). .. Two guide RNAs (gRNAs) (Target_1-318: CGTCTCTCTTGCACGCCGAA; Target_2-442: CGGGTCAGCAAGACGCCCCG) were obtained from Applied Biological Materials and separately cloned into pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro to increase the chances of generating a KO line.

    Article Title: DENND6A couples Arl8b to a Rab34/RILP/dynein complex regulating retrograde lysosomal trafficking and autophagy
    Article Snippet: .. The following constructs were custom synthesized by SynBio technologies: mito-mScarlet-DENND6A (DENND6A is human; vector-pmScarlet-i_C1, addgene 85044), mito-mScarlet (vector-pmScarlet-i_C1, Addgene 85044), DENND6A-GFP (vector-pEGFP-N1), GFP (vector-pEGFP-N1), PEX3(amino acids 1-42)-FKBP-mCherry (FK506-binding protein domain (FKBP) fragment was synthesized as per addgene 46944; vector-pEGFP-C1), FRB-GFP (FRB was amplified from addgene 59352; vector-pEGFP-N1), DENND6A-FRB-EGFP (vector-pEGFP-N1), GST-Rab34 (vector pGEX-6p-1), GST-Rab34-Q111L (vector-pGEX-6p-1), GST-Rab34-T66N (vector-pGEX-6p-1), T7-RILP (vector-pET-24a(+)), mCherry-Rab34 (vector-pEGFP-C1; replaced EGFP with custom synthesized Arl8b-mCherry), Arl8b-mCherry (vector-vector-pEGFP-C1; replaced EGFP with mCherry), GST-Arl8b QL (vector-pGEX-6p-1), GST-Arl8b TN (vector-pGEX-6p-1). .. Two guide RNAs (gRNAs) (Target_1-318: CGTCTCTCTTGCACGCCGAA; Target_2-442: CGGGTCAGCAAGACGCCCCG) were obtained from Applied Biological Materials and separately cloned into pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro to increase the chances of generating a KO line.

    Article Title: DENND6A links Arl8b to a Rab34/RILP/dynein complex, regulating lysosomal positioning and autophagy
    Article Snippet: .. The following constructs were custom synthesized by SynBio technologies: mito-mScarlet-DENND6A (DENND6A is human; vector- pmScarlet-i_C1, addgene 85044), mito-mScarlet (vector- pmScarlet-i_C1, Addgene 85044), DENND6A-GFP (vector- pEGFP-N1), GFP (vector- pEGFP-N1), PEX3(amino acids 1-42)-FKBP-mCherry (FK506-binding protein domain (FKBP) fragment was synthesized as per addgene 46944; vector- pEGFP-C1), FRB-GFP (FRB was amplified from addgene 59352; vector- pEGFP-N1), DENND6A-FRB-EGFP (vector- pEGFP-N1), GST-Rab34 (vector pGEX-6p-1), GST-Rab34-Q111L (vector- pGEX-6p-1), GST-Rab34-T66N (vector- pGEX-6p-1), T7-RILP (vector- pET-24a(+)), mCherry-Rab34 (vector- pEGFP-C1; replaced EGFP with custom synthesized Arl8b-mCherry), Arl8b-mCherry (vector- pEGFP-C1; replaced EGFP with mCherry), GST-Arl8b QL (vector- pGEX-6p-1), GST-Arl8b TN (vector- pGEX-6p-1), mito-mScarlet-Arl8b QL (vector- pmScarlet-i_C1), mito-mScarlet-Arl8b QL (vector- pmScarlet-i_C1), Arl8b QL-FLAG (vector- pEGFP-C1, EGFP was replaced by custom synthesized Arl8b QL-FLAG), Arl8b TN-FLAG (vector- pEGFP-C1, EGFP was replaced by custom synthesized Arl8b QL-FLAG), GFP-Rab34 Q111L (pEGFP-C1), mScarlet-Rab34 (vector- pmScarlet-i_C1), GFP-DENND6A (vector- pEGFP-C1). ..

    Amplification:

    Article Title: DENND6A couples Arl8b to a Rab34/RILP/dynein complex regulating retrograde lysosomal trafficking and autophagy
    Article Snippet: .. The following constructs were custom synthesized by SynBio technologies: mito-mScarlet-DENND6A (DENND6A is human; vector- pmScarlet-i_C1, addgene 85044), mito-mScarlet (vector- pmScarlet-i_C1, Addgene 85044), DENND6A-GFP (vector- pEGFP-N1), GFP (vector- pEGFP-N1), PEX3(amino acids 1-42)-FKBP-mCherry (FK506-binding protein domain (FKBP) fragment was synthesized as per addgene 46944; vector- pEGFP-C1), FRB-GFP (FRB was amplified from addgene 59352; vector- pEGFP-N1), DENND6A-FRB-EGFP (vector- pEGFP-N1), GST-Rab34 (vector pGEX-6p-1), GST-Rab34Q111L (vector- pGEX-6p-1), GST-Rab34-T66N (vector- pGEX-6p-1), T7-RILP (vector- pET24a(+)), mCherry-Rab34 (vector- pEGFP-C1; replaced EGFP with custom synthesized Arl8bmCherry), Arl8b-mCherry (vector- vector- pEGFP-C1; replaced EGFP with mCherry), GSTArl8b QL (vector- pGEX-6p-1), GST-Arl8b TN (vector- pGEX-6p-1). .. Two guide RNAs (gRNAs) (Target_1-318: CGTCTCTCTTGCACGCCGAA; Target_2-442: CGGGTCAGCAAGACGCCCCG) were obtained from Applied Biological Materials and separately cloned into pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro to increase the chances of generating a KO line.

    Article Title: DENND6A couples Arl8b to a Rab34/RILP/dynein complex regulating retrograde lysosomal trafficking and autophagy
    Article Snippet: .. The following constructs were custom synthesized by SynBio technologies: mito-mScarlet-DENND6A (DENND6A is human; vector-pmScarlet-i_C1, addgene 85044), mito-mScarlet (vector-pmScarlet-i_C1, Addgene 85044), DENND6A-GFP (vector-pEGFP-N1), GFP (vector-pEGFP-N1), PEX3(amino acids 1-42)-FKBP-mCherry (FK506-binding protein domain (FKBP) fragment was synthesized as per addgene 46944; vector-pEGFP-C1), FRB-GFP (FRB was amplified from addgene 59352; vector-pEGFP-N1), DENND6A-FRB-EGFP (vector-pEGFP-N1), GST-Rab34 (vector pGEX-6p-1), GST-Rab34-Q111L (vector-pGEX-6p-1), GST-Rab34-T66N (vector-pGEX-6p-1), T7-RILP (vector-pET-24a(+)), mCherry-Rab34 (vector-pEGFP-C1; replaced EGFP with custom synthesized Arl8b-mCherry), Arl8b-mCherry (vector-vector-pEGFP-C1; replaced EGFP with mCherry), GST-Arl8b QL (vector-pGEX-6p-1), GST-Arl8b TN (vector-pGEX-6p-1). .. Two guide RNAs (gRNAs) (Target_1-318: CGTCTCTCTTGCACGCCGAA; Target_2-442: CGGGTCAGCAAGACGCCCCG) were obtained from Applied Biological Materials and separately cloned into pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro to increase the chances of generating a KO line.

    Article Title: DENND6A links Arl8b to a Rab34/RILP/dynein complex, regulating lysosomal positioning and autophagy
    Article Snippet: .. The following constructs were custom synthesized by SynBio technologies: mito-mScarlet-DENND6A (DENND6A is human; vector- pmScarlet-i_C1, addgene 85044), mito-mScarlet (vector- pmScarlet-i_C1, Addgene 85044), DENND6A-GFP (vector- pEGFP-N1), GFP (vector- pEGFP-N1), PEX3(amino acids 1-42)-FKBP-mCherry (FK506-binding protein domain (FKBP) fragment was synthesized as per addgene 46944; vector- pEGFP-C1), FRB-GFP (FRB was amplified from addgene 59352; vector- pEGFP-N1), DENND6A-FRB-EGFP (vector- pEGFP-N1), GST-Rab34 (vector pGEX-6p-1), GST-Rab34-Q111L (vector- pGEX-6p-1), GST-Rab34-T66N (vector- pGEX-6p-1), T7-RILP (vector- pET-24a(+)), mCherry-Rab34 (vector- pEGFP-C1; replaced EGFP with custom synthesized Arl8b-mCherry), Arl8b-mCherry (vector- pEGFP-C1; replaced EGFP with mCherry), GST-Arl8b QL (vector- pGEX-6p-1), GST-Arl8b TN (vector- pGEX-6p-1), mito-mScarlet-Arl8b QL (vector- pmScarlet-i_C1), mito-mScarlet-Arl8b QL (vector- pmScarlet-i_C1), Arl8b QL-FLAG (vector- pEGFP-C1, EGFP was replaced by custom synthesized Arl8b QL-FLAG), Arl8b TN-FLAG (vector- pEGFP-C1, EGFP was replaced by custom synthesized Arl8b QL-FLAG), GFP-Rab34 Q111L (pEGFP-C1), mScarlet-Rab34 (vector- pmScarlet-i_C1), GFP-DENND6A (vector- pEGFP-C1). ..



    Similar Products

    addgene 46944  (Addgene inc)
    92
    Addgene inc addgene 46944
    Addgene 46944, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+46944/pIRES-Ap2a2-FKBP+(Plasmid+%2346944)/pmc10830484-337-40-49
    Average 92 stars, based on 1 article reviews
    addgene 46944 - by Bioz Stars, 2026-09
    92/100 stars
    		  Buy from Supplier

    Image Search Results